shRNA Adeno-associated Virus Serotype 2, pH1-(OR4K5-shRNA-Seq6)(CAT#: AAV-SI2557WQ)

This product is a OR4K5-shRNA encoding AAV, which is based on AAV-2 serotype. The OR4K5 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR4K5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert OR4K5-shRNA-Seq6
Related Target/Protein OR4K5
Region CDS
TargetSeq GCTACTTGTTTCGATGGCCTA
NCBI RefSeq NM_001005483
Alternative Names OR14-16
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 79317
Uniprot ID Q8NGD3

Related Products