shRNA Adeno-associated Virus Serotype 2, pH1-(CEP76-shRNA-Seq2)(CAT#: AAV-SI0739WQ)
This product is a CEP76-shRNA encoding AAV, which is based on AAV-2 serotype. The CEP76 gene encodes a centrosomal protein which regulates centriole amplification by limiting centriole duplication to once per cell cycle. The expression of CEP76-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | CEP76-shRNA-Seq2 |
| Related Target/Protein | CEP76 |
| Region | 3UTR |
| TargetSeq | GATATTTGAGACTGTCCAGAA |
| NCBI RefSeq | NM_024899 |
| Alternative Names | C18orf9; HsT1705 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Centriole reduplication |
