shRNA Adeno-associated Virus Serotype 2, pH1-(Cma2-shRNA-Seq1)(CAT#: AAV-SI3070WQ)

This product is a Cma2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Zcchc5 gene has serine-type endopeptidase activity. The expression of Cma2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Cma2-shRNA-Seq1
Related Target/Protein Cma2
Region 3UTR
TargetSeq CATCAGAGTCTTCAAGCCAGA
NCBI RefSeq NM_001024714
Alternative Names Mcp10
Titer >1*10^10 GC/mL
Target Gene
Gene ID 545055
Uniprot ID A0A2I3BR33

Related Products

Inquiry Now
Advertisement