shRNA Adeno-associated Virus Serotype 2, pH1-(DDX3Y-shRNA-Seq1)(CAT#: AAV-SI0517WQ)

This product is a DDX3Y-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by DDX3Y is a member of the DEAD-box RNA helicase family and is thought to be involved in ATP binding, hydrolysis, RNA binding, and in the formation of intramolecular interactions. Mutations in this gene result in male infertility, a reduction in germ cell numbers, and can result in Sertoli-cell only sydrome. The expression of DDX3Y-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert DDX3Y-shRNA-Seq1
Related Target/Protein DDX3Y
Region 3UTR
TargetSeq GCCAGCAGTATTCTTCAGTAA
NCBI RefSeq NM_004660
Alternative Names DBY
Titer >1*10^10 GC/mL
Related Diseases Male infertility, Sertoli cell-only syndrome or severe hypospermatogenesis
Target Gene
Gene ID 8653
Uniprot ID O15523

Related Products