shRNA Adeno-associated Virus Serotype 2, pH1-(EFCAB4A-shRNA-Seq1)(CAT#: AAV-SI0890WQ)
This product is a EFCAB4A-shRNA encoding AAV, which is based on AAV-2 serotype. The EFCAB4A gene plays a role in store-operated Ca2+ entry (SOCE). The expression of EFCAB4A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | EFCAB4A-shRNA-Seq1 |
| Related Target/Protein | EFCAB4A |
| Region | CDS |
| TargetSeq | GCTGTTTCTGCTGTGTGACAA |
| NCBI RefSeq | NM_173584 |
| Alternative Names | CRACR2B |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Chronic bronchitis |
