shRNA Adeno-associated Virus Serotype 2, pH1-(Eif4h-shRNA-Seq3)(CAT#: AAV-SI2780WQ)

This product is a Eif4h-shRNA encoding AAV, which is based on AAV-2 serotype. The Eif4h gene encodes one of the translation initiation factors, which functions to stimulate the initiation of protein synthesis at the level of mRNA utilization. The expression of Eif4h-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Eif4h-shRNA-Seq3
Related Target/Protein Eif4h
Region CDS
TargetSeq GTGGTTCAGAAGGAGCAAGAA
NCBI RefSeq NM_033561
Alternative Names WSCR1; WBSCR1; eIF-4H
Titer >1*10^10 GC/mL
Related Diseases Williams syndrome
Target Gene
Gene ID 7458
Uniprot ID Q15056

Related Products

Inquiry Now
Advertisement