shRNA Adeno-associated Virus Serotype 2, pH1-(Fdx1-shRNA-Seq1)(CAT#: AAV-SI3099WQ)

This product is a Fdx1-shRNA encoding AAV, which is based on AAV-2 serotype. The Fdx1 gene encodes a small iron-sulfur protein that transfers electrons from NADPH through ferredoxin reductase to mitochondrial cytochrome P450, involved in steroid, vitamin D, and bile acid metabolism. The expression of Fdx1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Fdx1-shRNA-Seq1
Related Target/Protein Fdx1
Region CDS
TargetSeq GCCATTACTGATGAAGAGAAT
NCBI RefSeq NM_007996
Alternative Names ADX; FDX; LOH11CR1D
Titer >1*10^10 GC/mL
Target Gene
Gene ID 2230
Uniprot ID P10109

Related Products