shRNA Adeno-associated Virus Serotype 2, pH1-(Fdx1-shRNA-Seq1)(CAT#: AAV-SI3099WQ)
This product is a Fdx1-shRNA encoding AAV, which is based on AAV-2 serotype. The Fdx1 gene encodes a small iron-sulfur protein that transfers electrons from NADPH through ferredoxin reductase to mitochondrial cytochrome P450, involved in steroid, vitamin D, and bile acid metabolism. The expression of Fdx1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Fdx1-shRNA-Seq1 |
Related Target/Protein | Fdx1 |
Region | CDS |
TargetSeq | GCCATTACTGATGAAGAGAAT |
NCBI RefSeq | NM_007996 |
Alternative Names | ADX; FDX; LOH11CR1D |
Titer | >1*10^10 GC/mL |