shRNA Adeno-associated Virus Serotype 2, pH1-(Gsdma3-shRNA-Seq1)(CAT#: AAV-SI3179WQ)

This product is a Gsdma3-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Gsdma3 gene may play a role in the transition from catagen to telogen at the end of hair follicle morphogenesis. The expression of Gsdma3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Gsdma3-shRNA-Seq1
Related Target/Protein Gsdma3
Region CDS
TargetSeq GCTCTGACAGAGCTAACTGAA
NCBI RefSeq NM_001007461
Alternative Names Bsk; Dfl; Fgn; Rco2; Rim3; Gsdm3; Gsdm1l
Titer >1*10^10 GC/mL
Target Gene
Gene ID 450219
Uniprot ID Q5Y4Y6

Related Products

Advertisement