shRNA Adeno-associated Virus Serotype 2, pH1-(Hsph1-shRNA-Seq2)(CAT#: AAV-SI2816WQ)

This product is a Hsph1-shRNA encoding AAV, which is based on AAV-2 serotype. The Hsph1 gene encodes a member of the heat shock protein 70 family of proteins and functions as a nucleotide exchange factor for the molecular chaperone heat shock cognate 71 kDa protein (Hsc70). The expression of Hsph1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Hsph1-shRNA-Seq2
Related Target/Protein Hsph1
Region CDS
TargetSeq CGGCTGTTGCTTTGAATTATG
NCBI RefSeq NM_013559
Alternative Names HSP105; HSP105A; HSP105B; NY-CO-25
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 10808
Uniprot ID Q92598

Related Products

Advertisement