shRNA Adeno-associated Virus Serotype 2, pH1-(LRRC27-shRNA-Seq2)(CAT#: AAV-SI0747WQ)

This product is a LRRC27-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of LRRC27-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert LRRC27-shRNA-Seq2
Related Target/Protein LRRC27
Region CDS
TargetSeq GTCTAACCAAGGAGCTGTGAA
NCBI RefSeq NM_030626
Titer >1*10^10 GC/mL
Target Gene
Gene ID 80313
Uniprot ID Q9C0I9

Related Products

Advertisement