shRNA Adeno-associated Virus Serotype 2, pH1-(MAP6D1-shRNA-Seq2)(CAT#: AAV-SI0699WQ)

This product is a MAP6D1-shRNA encoding AAV, which is based on AAV-2 serotype. The MAP6D1 gene encodes a protein highly similar to the mouse MAP6 domain containing 1 protein, which is related to the STOP proteins. The expression of MAP6D1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert MAP6D1-shRNA-Seq2
Related Target/Protein MAP6D1
Region CDS
TargetSeq CCTCAAGATCCACAAAGACAA
NCBI RefSeq NM_024871
Alternative Names SL21; MAPO6D1
Titer >1*10^10 GC/mL
Related Diseases Renal cancer
Target Gene
Gene ID 79929
Uniprot ID Q9H9H5

Related Products

Inquiry Now
Advertisement