shRNA Adeno-associated Virus Serotype 2, pH1-(N4bp2-shRNA-Seq2)(CAT#: AAV-SI2774WQ)
This product is a N4bp2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by N4bp2 gene binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. The expression of N4bp2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | N4bp2-shRNA-Seq2 |
Related Target/Protein | N4bp2 |
Region | CDS |
TargetSeq | CTCCAGTAATCATAGATAATA |
NCBI RefSeq | NM_001024917 |
Alternative Names | B3BP |
Titer | >1*10^10 GC/mL |
Related Diseases | B-cell leukemia/lymphoma |