shRNA Adeno-associated Virus Serotype 2, p7SK-(C7orf42-shRNA-Seq1)(CAT#: AAV-SI1337WQ)

This product is a C7orf42-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C7orf42-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C7orf42-shRNA-Seq1
Related Target/Protein C7orf42
Region 3UTR
TargetSeq CCCAATATGTAGAGAACATTT
NCBI RefSeq NM_017994
Alternative Names TMEM248
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55069
Uniprot ID Q9NWD8

Related Products