shRNA Adeno-associated Virus Serotype 2, pH1-(OR5M11-shRNA-Seq1)(CAT#: AAV-SI2417WQ)

This product is a OR5M11-shRNA encoding AAV, which is based on AAV-2 serotype. The OR5M11 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR5M11-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert OR5M11-shRNA-Seq1
Related Target/Protein OR5M11
Region CDS
TargetSeq CCCGCAGATGTCGACTAATAT
NCBI RefSeq NM_001005245
Alternative Names OR11-199
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 219487
Uniprot ID Q96RB7

Related Products