shRNA Adeno-associated Virus Serotype 2, pH1-(OR8J3-shRNA-Seq3)(CAT#: AAV-SI2962WQ)

This product is a OR8J3-shRNA encoding AAV, which is based on AAV-2 serotype. The OR8J3 gene encodes an odorant receptor. The expression of OR8J3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert OR8J3-shRNA-Seq3
Related Target/Protein OR8J3
Region CDS
TargetSeq CACCTCTGTTAGCATTATCTT
NCBI RefSeq NM_001004064
Alternative Names OR11-173
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 81168
Uniprot ID Q8NGG0

Related Products

Inquiry Now
Advertisement