shRNA Adeno-associated Virus Serotype 2, pH1-(PCMTD1-shRNA-Seq2)(CAT#: AAV-SI0577WQ)

This product is a PCMTD1-shRNA encoding AAV, which is based on AAV-2 serotype. PCMTD1 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-L-isoaspartate (D-aspartate) O-methyltransferase activity. The expression of PCMTD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert PCMTD1-shRNA-Seq2
Related Target/Protein PCMTD1
Region 3UTR
TargetSeq GCTCCAGTAATTCCACAACAT
NCBI RefSeq NM_052937
Titer >1*10^10 GC/mL
Related Diseases Glaucoma, Lung cancer
Target Gene
Gene ID 115294
Uniprot ID Q96MG8

Related Products

Advertisement