shRNA Adeno-associated Virus Serotype 2, pU6-(D730001G18Rik-shRNA-Seq1)(CAT#: AAV-SI2349WQ)
This product is a D730001G18Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by D730001G18Rik has acetylcholine receptor inhibitor activity. The expression of D730001G18Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | D730001G18Rik-shRNA-Seq1 |
| Related Target/Protein | D730001G18Rik |
| Region | CDS |
| TargetSeq | CCTCTATGAGACCTTCAGAGT |
| NCBI RefSeq | NM_172433 |
| Alternative Names | Ly6g6g |
| Titer | >1*10^10 GC/mL |
| Target Gene | |
|---|---|
| Gene ID | 78725 |
| Uniprot ID | A0A087WQU7 |
