shRNA Adeno-associated Virus Serotype 2, pH1-(PCOLCE-shRNA-Seq1)(CAT#: AAV-SI0904WQ)
This product is a PCOLCE-shRNA encoding AAV, which is based on AAV-2 serotype. The PCOLCE gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. The expression of PCOLCE-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | PCOLCE-shRNA-Seq1 |
Related Target/Protein | PCOLCE |
Region | CDS |
TargetSeq | GAATGAACTCCTCGTCCAGTT |
NCBI RefSeq | NM_002593 |
Alternative Names | PCPE; PCPE1; PCPE-1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Psoriatic arthritis |