shRNA Adeno-associated Virus Serotype 2, pH1-(Tlcd2-shRNA-Seq1)(CAT#: AAV-SI3133WQ)

This product is a Tlcd2-shRNA encoding AAV, which is based on AAV-2 serotype. The Tlcd2 gene encodes a protein that may regulate the composition and fluidity of the plasma membrane. The expression of Tlcd2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Tlcd2-shRNA-Seq1
Related Target/Protein Tlcd2
Region CDS
TargetSeq CATCTGTTTGCATCTACGGAA
NCBI RefSeq NM_027249
Titer >1*10^10 GC/mL
Target Gene
Gene ID 727910
Uniprot ID A6NGC4

Related Products

Advertisement