shRNA Adeno-associated Virus Serotype 2, pH1-(PRPF18-shRNA-Seq1)(CAT#: AAV-SI0522WQ)
This product is a PRPF18-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by PRPF18 gene is found to be essential for the catalytic step II in pre-mRNA splicing process. Mutations in this gene result in RNA synthesis dysfunction.The expression of PRPF18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | PRPF18-shRNA-Seq1 |
Related Target/Protein | PRPF18 |
Region | 3UTR |
TargetSeq | GATCTGTGTATGGTGTGTTAA |
NCBI RefSeq | NM_003675 |
Alternative Names | PRP18; hPrp18 |
Titer | >1*10^10 GC/mL |
Related Diseases | late-onset Alzheimer disease (LOAD) |