shRNA Adeno-associated Virus Serotype 2, pH1-(SERINC5-shRNA-Seq1)(CAT#: AAV-SI0997WQ)

This product is a SERINC5-shRNA encoding AAV, which is based on AAV-2 serotype. The SERINC5 gene impairs the penetration of the viral particle into the cytoplasm and enhances the incorporation of serine into phosphatidylserine and sphingolipids. May play a role in providing serine molecules for the formation of myelin glycosphingolipids in oligodendrocytes. The expression of SERINC5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SERINC5-shRNA-Seq1
Related Target/Protein SERINC5
Region CDS
TargetSeq CACCGTCTACATCTACTCCTA
NCBI RefSeq NM_178276
Alternative Names TPO1; C5orf12
Titer >1*10^10 GC/mL
Related Diseases HIV infection
Target Gene
Gene ID 256987
Uniprot ID Q86VE9

Related Products