shRNA Adeno-associated Virus Serotype 2, pH1-(F8-shRNA-Seq2)(CAT#: AAV-SI0761WQ)

This product is a F8-shRNA encoding AAV, which is based on AAV-2 serotype. The F8 gene encodes coagulation factor VIII, which participates in the intrinsic pathway of blood coagulation; factor VIII is a cofactor for factor IXa which, in the presence of Ca+2 and phospholipids, converts factor X to the activated form Xa. The expression of F8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert F8-shRNA-Seq2
Related Target/Protein F8
Region 3UTR
TargetSeq GCCTCCTGAATTAACTATCAT
NCBI RefSeq NM_000132
Alternative Names AHF; F8B; F8C; HEMA; FVIII; DXS1253E
Titer >1*10^10 GC/mL
Related Diseases Hemophilia A, a common recessive X-linked coagulation disorder
Target Gene
Gene ID 2157
Uniprot ID P00451

Related Products

Advertisement