shRNA Adeno-associated Virus Serotype 2, pH1-(SGMS2-shRNA-Seq2)(CAT#: AAV-SI2948WQ)
This product is a SGMS2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by SGMS2 gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The expression of SGMS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SGMS2-shRNA-Seq2 |
Related Target/Protein | SGMS2 |
Region | CDS |
TargetSeq | CCAGTGATCCTACGAACACTT |
NCBI RefSeq | NM_152621 |
Alternative Names | CDL; SMS2 |
Titer | >1*10^10 GC/mL |