shRNA Adeno-associated Virus Serotype 2, pH1-(SGMS2-shRNA-Seq2)(CAT#: AAV-SI2948WQ)
This product is a SGMS2-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by SGMS2 gene is an enzyme that catalyzes this reaction primarily at the cell membrane. The expression of SGMS2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | SGMS2-shRNA-Seq2 |
| Related Target/Protein | SGMS2 |
| Region | CDS |
| TargetSeq | CCAGTGATCCTACGAACACTT |
| NCBI RefSeq | NM_152621 |
| Alternative Names | CDL; SMS2 |
| Titer | >1*10^10 GC/mL |
