shRNA Adeno-associated Virus Serotype 2, pU6-(Zfand2a-shRNA-Seq1)(CAT#: AAV-SI2216WQ)

This product is a Zfand2a-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Zfand2a gene has zinc ion binding ability. The expression of Zfand2a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Zfand2a-shRNA-Seq1
Related Target/Protein Zfand2a
Region CDS
TargetSeq CAATAACATGCGACGCCTGTA
NCBI RefSeq NM_133349
Alternative Names AIRAP
Titer >1*10^10 GC/mL
Target Gene
Gene ID 90637
Uniprot ID Q8N6M9

Related Products

Advertisement