shRNA Adeno-associated Virus Serotype 2, pH1-(SH3D19-shRNA-Seq1)(CAT#: AAV-SI0777WQ)
This product is a SH3D19-shRNA encoding AAV, which is based on AAV-2 serotype. The SH3D19 gene encoded protein may be involved in suppression of Ras-induced cellular transformation and Ras-mediated activation of ELK1 by EBP, and regulation of ADAM proteins in the signaling of EGFR-ligand shedding. The expression of SH3D19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | SH3D19-shRNA-Seq1 |
Related Target/Protein | SH3D19 |
Region | 3UTR |
TargetSeq | GCTTGAGCATATCAGCCTTAT |
NCBI RefSeq | NM_001009555 |
Alternative Names | EBP; EVE1; Kryn; Eve-1; SH3P19 |
Titer | >1*10^10 GC/mL |
Related Diseases | Acute myeloid leukemia |