shRNA Adeno-associated Virus Serotype 2, p7SK-(Spdyb-shRNA-Seq1)(CAT#: AAV-SI3929WQ)

This product is a Spdyb-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of Spdyb-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Spdyb-shRNA-Seq1
Related Target/Protein Spdyb
Region CDS
TargetSeq CTGGCTCTATCCAGCTTACAA
NCBI RefSeq NM_029048
Alternative Names SPY1; SPDY1; RINGO3; RINGOA
Titer >1*10^10 GC/mL
Target Gene
Gene ID 245711
Uniprot ID I6XC90

Related Products

Inquiry Now
Advertisement