shRNA Adeno-associated Virus Serotype 2, pH1-(Tha1-shRNA-Seq1)(CAT#: AAV-SI3089WQ)

This product is a Tha1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Tha1 gene has L-allo-threonine aldolase activity. The expression of Tha1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Tha1-shRNA-Seq1
Related Target/Protein Tha1
Region 3UTR
TargetSeq CTGGAGGATGGTGACATCATT
NCBI RefSeq NM_027919
Alternative Names GLY1; 1300017K07Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 71776
Uniprot ID Q9DBC9

Related Products

Advertisement