shRNA Adeno-associated Virus Serotype 2, p7SK-(MUM1L1-shRNA-Seq1)(CAT#: AAV-SI1456WQ)
This product is a MUM1L1-shRNA encoding AAV, which is based on AAV-2 serotype. The MUM1L1 gene encodes a protein which contains a mutated melanoma-associated antigen 1 domain. The expression of MUM1L1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | MUM1L1-shRNA-Seq1 |
Related Target/Protein | MUM1L1 |
Region | CDS |
TargetSeq | CACATCCGTTTGAAACAGGAA |
NCBI RefSeq | NM_152423 |
Alternative Names | MUM1L1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Endometrial carcinoma |