shRNA Adeno-associated Virus Serotype 2, p7SK-(Tatdn1-shRNA-Seq1)(CAT#: AAV-SI3923WQ)
This product is a Tatdn1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Tatdn1 gene is putative deoxyribonuclease. The expression of Tatdn1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | Tatdn1-shRNA-Seq1 |
| Related Target/Protein | Tatdn1 |
| Region | CDS |
| TargetSeq | CAACCTGACAGATCCTATGTT |
| NCBI RefSeq | NM_175151 |
| Alternative Names | CDA11 |
| Titer | >1*10^10 GC/mL |
