shRNA Adeno-associated Virus Serotype 2, pU6-(1500015O10Rik-shRNA-Seq1)(CAT#: AAV-SI2236WQ)

This product is a 1500015O10Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The products of 1500015O10Rik gene is probable hormone that may attenuate cell proliferation and induce senescence of oligodendrocyte and neural precursor cells in the central nervous system. The expression of 1500015O10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 1500015O10Rik-shRNA-Seq1
Related Target/Protein 1500015O10Rik
Region CDS
TargetSeq CCGAGAACACAGCAAAGGAAT
NCBI RefSeq NM_024283
Alternative Names Ecrg4
Titer >1*10^10 GC/mL
Related Diseases Nervous system disease
Target Gene
Gene ID 78896
Uniprot ID Q99LS0

Related Products

Inquiry Now
Advertisement