shRNA Adeno-associated Virus Serotype 2, pU6-(2310044H10Rik-shRNA-Seq3)(CAT#: AAV-SI1949WQ)
This product is a 2310044H10Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 2310044H10Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | 2310044H10Rik-shRNA-Seq3 |
Related Target/Protein | 2310044H10Rik |
Region | CDS |
TargetSeq | CAGAAGTCTTTCTTTGCCAAA |
NCBI RefSeq | NM_197991 |
Alternative Names | Inm02; Mirta22; Emc10; 5430410O10Rik |
Titer | >1*10^10 GC/mL |
Target Gene | |
---|---|
Gene ID | 69683 |
Uniprot ID | A0A0X1KG67 |