shRNA Adeno-associated Virus Serotype 2, pU6-(SPAM1-shRNA-Seq2)(CAT#: AAV-SI1507WQ)

This product is a SPAM1-shRNA encoding AAV, which is based on AAV-2 serotype. The SPAM1 gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. The expression of SPAM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert SPAM1-shRNA-Seq2
Related Target/Protein SPAM1
Region CDS
TargetSeq GCAAGGAGTGTGTATAAGGAA
NCBI RefSeq NM_003117
Alternative Names HYA1; PH20; HYAL1; HYAL3; HYAL5; PH-20; SPAG15; HEL-S-96n
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 6677
Uniprot ID P38567

Related Products