shRNA Adeno-associated Virus Serotype 2, pU6-(2510003E04Rik-shRNA-Seq1)(CAT#: AAV-SI2219WQ)

This product is a 2510003E04Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 2510003E04Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 2510003E04Rik-shRNA-Seq1
Related Target/Protein 2510003E04Rik
Region 3UTR
TargetSeq CCTAATTATGTAAGTTGCCTT
NCBI RefSeq NM_028197
Alternative Names KBP; mKIAA1279; 0710007C18Rik; Kif1bp
Titer >1*10^10 GC/mL
Target Gene
Gene ID 72320
Uniprot ID H3BIY2

Related Products

Inquiry Now
Advertisement