shRNA Adeno-associated Virus Serotype 2, pU6-(2700062C07Rik-shRNA-Seq1)(CAT#: AAV-SI2224WQ)

This product is a 2700062C07Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 2700062C07Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 2700062C07Rik-shRNA-Seq1
Related Target/Protein 2700062C07Rik
Region CDS
TargetSeq GAAACACTTCTCTCAACTAAA
NCBI RefSeq NM_026529
Alternative Names C87515; AI195775
Titer >1*10^10 GC/mL
Target Gene
Gene ID 68046
Uniprot ID A0A3Q4EGR9

Related Products

Advertisement