shRNA Adeno-associated Virus Serotype 2, pU6-(4933409G03Rik-shRNA-Seq5)(CAT#: AAV-SI1797WQ)

This product is a 4933409G03Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 4933409G03Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 4933409G03Rik-shRNA-Seq5
Related Target/Protein 4933409G03Rik
Region CDS
TargetSeq GAGGATAACGACGGTGATGAT
NCBI RefSeq NM_177651
Titer >1*10^10 GC/mL
Target Gene
Gene ID 227998
Uniprot ID Q8C5U0

Related Products

Advertisement