shRNA Adeno-associated Virus Serotype 2, pU6-(Gpatch2-shRNA-Seq5)(CAT#: AAV-SI1829WQ)
This product is a Gpatch2-shRNA encoding AAV, which is based on AAV-2 serotype. The Gpatch2 gene encodes a nuclear factor that may play a role in spermatogenesis and in tumor growth during breast cancer. Mutations in this gene cause Joubert syndrome (JBTS). The expression of Gpatch2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Gpatch2-shRNA-Seq5 |
Related Target/Protein | Gpatch2 |
Region | 3UTR |
TargetSeq | CGCCAGTGATAGAAATGGGAT |
NCBI RefSeq | NM_026367 |
Alternative Names | Pfa1; CT110; GPATC2; PPP1R30 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |