shRNA Adeno-associated Virus Serotype 2, pU6-(9130011J15Rik-shRNA-Seq2)(CAT#: AAV-SI1716WQ)

This product is a 9130011J15Rik-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of 9130011J15Rik-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert 9130011J15Rik-shRNA-Seq2
Related Target/Protein 9130011J15Rik
Region 3UTR
TargetSeq CCTTGCTATAACCAGATATAT
NCBI RefSeq NM_172396
Alternative Names Smim7
Titer >1*10^10 GC/mL
Target Gene
Gene ID 66818
Uniprot ID F8WIU9

Related Products

Inquiry Now
Advertisement