shRNA Adeno-associated Virus Serotype 2, pU6-(AY358078-shRNA-Seq1)(CAT#: AAV-SI1799WQ)
This product is a AY358078-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of AY358078-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | AY358078-shRNA-Seq1 |
Related Target/Protein | AY358078 |
Region | CDS |
TargetSeq | GCATGATTTCTCAACTCTTAC |
NCBI RefSeq | NM_194347 |
Titer | >1*10^10 GC/mL |