shRNA Adeno-associated Virus Serotype 2, p7SK-(C9orf23-shRNA-Seq1)(CAT#: AAV-SI1319WQ)

This product is a C9orf23-shRNA encoding AAV, which is based on AAV-2 serotype. The C9orf23 gene encodes a protein that appears to belong to a family of evolutionarily related proteins (DUF78), that may share one or more domains in common. The expression of C9orf23-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C9orf23-shRNA-Seq1
Related Target/Protein C9orf23
Region CDS
TargetSeq CCAATGAGTGTGGTTACCAAC
NCBI RefSeq NM_148178
Alternative Names RPP25L; bA296L22.5
Titer >1*10^10 GC/mL
Target Gene
Gene ID 138716
Uniprot ID Q8N5L8

Related Products

Advertisement