shRNA Adeno-associated Virus Serotype 2, pU6-(Bcdin3d-shRNA-Seq1)(CAT#: AAV-SI2250WQ)
This product is a Bcdin3d-shRNA encoding AAV, which is based on AAV-2 serotype. The Bcdin3d gene encodes an RNA methyltransferase which belongs to the rossmann fold methyltransferase family, and serves as a 5'-methylphosphate capping enzyme that is specific for cytoplasmic histidyl tRNA. The expression of Bcdin3d-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Bcdin3d-shRNA-Seq1 |
Related Target/Protein | Bcdin3d |
Region | CDS |
TargetSeq | CTCTGTACAAACATTTCCTTT |
NCBI RefSeq | NM_029236 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |