shRNA Adeno-associated Virus Serotype 2, pU6-(Bcdin3d-shRNA-Seq1)(CAT#: AAV-SI2250WQ)

This product is a Bcdin3d-shRNA encoding AAV, which is based on AAV-2 serotype. The Bcdin3d gene encodes an RNA methyltransferase which belongs to the rossmann fold methyltransferase family, and serves as a 5'-methylphosphate capping enzyme that is specific for cytoplasmic histidyl tRNA. The expression of Bcdin3d-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Bcdin3d-shRNA-Seq1
Related Target/Protein Bcdin3d
Region CDS
TargetSeq CTCTGTACAAACATTTCCTTT
NCBI RefSeq NM_029236
Titer >1*10^10 GC/mL
Related Diseases Breast cancer
Target Gene
Gene ID 144233
Uniprot ID Q7Z5W3

Related Products

Inquiry Now
Advertisement