shRNA Adeno-associated Virus Serotype 2, pU6-(BTBD9-shRNA-Seq3)(CAT#: AAV-SI0415WQ)
This product is a BTBD9-shRNA encoding AAV, which is based on AAV-2 serotype. The BTBD9 gene encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. The expression of BTBD9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | BTBD9-shRNA-Seq3 |
| Related Target/Protein | BTBD9 |
| Region | CDS |
| TargetSeq | GCAGAAGCATTCACAATGCTA |
| NCBI RefSeq | NM_152733 |
| Alternative Names | dJ322I12.1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Tourette Syndrome |
