shRNA Adeno-associated Virus Serotype 2, pU6-(C1orf126-shRNA-Seq4)(CAT#: AAV-SI2095WQ)
This product is a C1orf126-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of C1orf126-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Parvoviridae |
| Species | Adeno-associated virus (AAV) |
| Serotype | AAV-2 |
| Backbone | AAV-2 |
| Tropism | CNS, muscle, liver, brain, eye |
| Insert | C1orf126-shRNA-Seq4 |
| Related Target/Protein | C1orf126 |
| Region | CDS |
| TargetSeq | CCCACAAATTACCGTAATGCA |
| NCBI RefSeq | NM_182534 |
| Alternative Names | C1orf126 |
| Titer | >1*10^10 GC/mL |
