shRNA Adeno-associated Virus Serotype 2, pU6-(C20orf43-shRNA-Seq1)(CAT#: AAV-SI0359WQ)

This product is a C20orf43-shRNA encoding AAV, which is based on AAV-2 serotype. The C20orf43 gene is required for ATR pathway signaling upon DNA damage and has a positive activity during DNA replication. The expression of C20orf43-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert C20orf43-shRNA-Seq1
Related Target/Protein C20orf43
Region CDS
TargetSeq GTTGAGAAGGTCGACAAAGAT
NCBI RefSeq NM_016407
Alternative Names CDAO5; RTFDC1; HSPC164; RTF2; SHUJUN-3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 51507
Uniprot ID Q9BY42

Related Products

Inquiry Now
Advertisement