shRNA Adeno-associated Virus Serotype 2, pU6-(CCT3-shRNA-Seq3)(CAT#: AAV-SI2104WQ)

This product is a CCT3-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by CCT3 gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). The expression of CCT3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CCT3-shRNA-Seq3
Related Target/Protein CCT3
Region CDS
TargetSeq GTGTAAATGGTGAGACGGGTA
NCBI RefSeq NM_005998
Alternative Names CCTG; PIG48; TRIC5; CCT-gamma; TCP-1-gamma
Titer >1*10^10 GC/mL
Target Gene
Gene ID 7203
Uniprot ID P49368

Related Products

Inquiry Now
Advertisement