shRNA Adeno-associated Virus Serotype 2, p7SK-(ARMC4-shRNA-Seq1)(CAT#: AAV-SI1089WQ)

This product is a ARMC4-shRNA encoding AAV, which is based on AAV-2 serotype. The ARMC4 gene encoded protein contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. The expression of ARMC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert ARMC4-shRNA-Seq1
Related Target/Protein ARMC4
Region 3UTR
TargetSeq GTTGTTAGCAAACCCTTTCAA
NCBI RefSeq NM_018076
Alternative Names CILD23
Titer >1*10^10 GC/mL
Related Diseases Primary ciliary dyskensia (PCD)
Target Gene
Gene ID 55130
Uniprot ID Q5T2S8

Related Products

Advertisement