shRNA Adeno-associated Virus Serotype 2, pU6-(COQ9-shRNA-Seq2)(CAT#: AAV-SI0120WQ)

This product is a COQ9-shRNA encoding AAV, which is based on AAV-2 serotype. The COQ9 gene encoded protein is likely necessary for biosynthesis of coenzyme Q10, as mutations at this locus have been associated with autosomal-recessive neonatal-onset primary coenzyme Q10 deficiency. The expression of COQ9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert COQ9-shRNA-Seq2
Related Target/Protein COQ9
Region CDS
TargetSeq CTATGAAAGTGAGGAGCAGTT
NCBI RefSeq NM_020312
Alternative Names COQ10D5; C16orf49; HSPC326; PSEC0129
Titer >1*10^10 GC/mL
Related Diseases Autosomal-recessive neonatal-onset primary coenzyme Q10 deficiency
Target Gene
Gene ID 57017
Uniprot ID O75208

Related Products

Inquiry Now
Advertisement