shRNA Adeno-associated Virus Serotype 2, pH1-(CEP170L-shRNA-Seq2)(CAT#: AAV-SI0925WQ)

This product is a CEP170L-shRNA encoding AAV, which is based on AAV-2 serotype. The expression of CEP170L-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert CEP170L-shRNA-Seq2
Related Target/Protein CEP170L
Region CDS
TargetSeq GCTGAATTTGAGAATGCTGAA
NCBI RefSeq NM_153243
Alternative Names FAM68B; CEP170L; KIAA0470L
Titer >1*10^10 GC/mL
Target Gene
Gene ID 645455
Uniprot ID Q96L14

Related Products

Advertisement