shRNA Adeno-associated Virus Serotype 2, pU6-(Csn1s1-shRNA-Seq1)(CAT#: AAV-SI2296WQ)

This product is a Csn1s1-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by Csn1s1 gene may play an important role in the capacity of milk to transport calcium phosphate. The expression of Csn1s1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert Csn1s1-shRNA-Seq1
Related Target/Protein Csn1s1
Region CDS
TargetSeq CCCACAAATCTTCCAGTATGA
NCBI RefSeq NM_007784
Alternative Names CASA; CSN1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 1446
Uniprot ID P47710

Related Products

Advertisement