shRNA Adeno-associated Virus Serotype 2, pU6-(Ctu2-shRNA-Seq1)(CAT#: AAV-SI1788WQ)
This product is a Ctu2-shRNA encoding AAV, which is based on AAV-2 serotype. The Ctu2 gene a protein which is involved in the post-transcriptional modification of transfer RNAs (tRNAs) and plays a role in thiolation of uridine residue present at the wobble position in a subset of tRNAs, resulting in enhanced codon reading accuracy. The expression of Ctu2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Parvoviridae |
Species | Adeno-associated virus (AAV) |
Serotype | AAV-2 |
Backbone | AAV-2 |
Tropism | CNS, muscle, liver, brain, eye |
Insert | Ctu2-shRNA-Seq1 |
Related Target/Protein | Ctu2 |
Region | CDS |
TargetSeq | CCTTCTACAACCACCTGTTTA |
NCBI RefSeq | NM_153775 |
Alternative Names | MFRG; NCS2; UPF0432; C16orf84 |
Titer | >1*10^10 GC/mL |