shRNA Adeno-associated Virus Serotype 2, pU6-(DHX8-shRNA-Seq3)(CAT#: AAV-SI0027WQ)

This product is a DHX8-shRNA encoding AAV, which is based on AAV-2 serotype. The protein encoded by DHX8 gene contains the DEAH (Asp-Glu-Ala-His) motif which is characteristic of all DEAH box proteins, and is thought to function as an ATP-dependent RNA helicase that regulates the release of spliced mRNAs from spliceosomes prior to their export from the nucleus.The expression of DHX8-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Parvoviridae
Species Adeno-associated virus (AAV)
Serotype AAV-2
Backbone AAV-2
Tropism CNS, muscle, liver, brain, eye
Insert DHX8-shRNA-Seq3
Related Target/Protein DHX8
Region CDS
TargetSeq CCACCAATATCGCAGAGACAT
NCBI RefSeq NM_004941
Alternative Names DDX8; Dhr2; HRH1; PRP22; PRPF22
Titer >1*10^10 GC/mL
Related Diseases HIV infection
Target Gene
Gene ID 1659
Uniprot ID Q14562

Related Products

Advertisement